IDEA

Interactive Display for Evolutionary Analyses

Version 2.5 (December 21, 2009)

Documentation Updated December 21, 2009


Table of Contents


1 Introduction

2 Running IDEA

3 Performing an Analysis 4 Viewing Results 5 New in IDEA 2.4

6 Further Information

1 Introduction

IDEA (Interactive Display for Evolutionary Analyses) provides a graphical interface for PAML (Phylogenetic Analysis by Maximum Likelihood, Ziheng Yang, 1997), a suite of programs for conducting molecular evolution analyses on nucleotide and amino-acid data.  IDEA allows you to run either of the PAML programs codeml or baseml on a single dataset or on multiple datasets simultaneously.  Among other things, codeml and baseml allow you to obtain maximum likelihood estimates of numbers of substitutions per branch and per site and to compare multiple models of molecular evolution given the data and a phylogenetic tree for the sequences.

IDEA allows you to:
 
• Run either of the PAML programs codeml or baseml.
• Optionally generate phylogenetic trees with PhyML, using maximum likelihood, or with PHYLIP, using maximum parsimony (small datasets) or neighbor-joining (large datasets).
• Perform multiple runs of codeml with different starting ω (dN/dS) values and merge their results for increased accuracy.
• Save parameter values for future use.
• Analyze many datasets in parallel.
• Monitor progress step by step.

If you run a `site models' analysis (seqtype = 1 , model = 0 ), you can use IDEA's graphical output interface to:
 
• Easily identify genes and sites under positive selection.
• Visualize selective pressure along a gene.

IDEA is maintained by Amy Egan.

IDEA Research Team:  Amy Egan and Joana C. Silva

Inquiries may be posted to the IDEA Support and Discussion Forum.


Running IDEA

After IDEA has been installed, it may be run by entering the IDEA installation directory (the directory in which idea-X.X.X.tar.gz was saved or, equivalently, the directory in which the executable idea is found) and typing idea .   For convenience, you may wish to add IDEA to your path; doing so will allow you to run IDEA by simply typing idea while in any directory.

The command for changing your path depends on which shell you are using.  Type echo $0 to find out which shell you are using.

In tcshset PATH = (${PATH}:/your/IDEA/installation/directory )
In bashexport PATH=$PATH:/your/IDEA/installation/directory

To add IDEA to your path permanently, add the appropriate command above to the .cshrc or .bashrc file in your home directory.


3 Performing an Analysis

Before starting an analysis, you should be sure your input data is in the expected format.

3.1 Expected Input

IDEA expects different input files depending on whether you have multiple datasets or a single dataset and whether you intend to use existing phylogenetic trees.  All these files should be in the same directory (or directory hierarchy).

3.1.1 Alignment File(s)

For each dataset,  IDEA expects a single nucleotide alignment file in PAML format (here referred to as PAMLseq), which is a gapped FASTA format with a header.

The format of the header is

<space> n <space> l

, where n is the number of sequences and l is the length of the nucleotide alignment.

Note:  We recommend avoiding sequence names beginning with numbers.

Below is an example PAMLseq alignment file.

 5 537
>species1
ATGGCATGTAAAGTTGATAAAGCTTTAGAGCATTCTACCCAAAATGAAGCACCCTCA---
---------AAAAATTATATGAACAATTTGTGTTATTACAAAAATAATGAATTAAAAAAA
ATAGACTCATCATATTTTCAAGATAAGTATTTAGGATTATTTTTTGGAGCTTCATGGTGT
AAATATTGTGTATCATTTATAAATAATTTGAATTTATTTAAAACCTACTTTCCCTTTTTT
GAAATAATATATATACCATTTGATCAAACATATACAGATTATATCAATTTTTTAAAAAAT
ACTAATTTTTATAGTTTACCTTTTGATAATTATTTATATATAGCTAATAAATTTAAAGTC
ACAAATTTGCCATCTTTTATTATTATAGCACCCAATAATAATATCCTTGTTAGGGATGGA
GTGCAATTAATTAAAACTGACAACTATATAAACAACTTCAAATCCTTGATAAAAAATTAT
ACAATACACCCCAAAACATTCAAATCAAATAATCGATTTTTCGATTTATTCTACAAT
>species2
ATGGCTTGTAAAGTTGATAAAGCTCCAGAGCATCCTACCCAAAATGAAGTACCCTCA---
---------CAAAATTATATGAACAATTTATGTTATTACAAAAATAATGAATTAAAAAAA
ATAGACTCATCATATTTTCAAGATAAATATTTAGGATTATTTTTTGGAGCCTCATGGTGT
AAATATTGTGTATCATTTATAAATAATTTGAATTTATTTAAAACCTACTTCCCCTTCTTT
GAAATCATATATATACCATTTGATCAAACATATACAGATTATATTAATTTTTTAAAAAAT
ACAAATTTCTATAGCTTACCTTTTGATAATTATTTATATATAGCTAATAAATTTAAAGTC
AAAAATTTACCATCATTTATTATTATAGCACCCAATAATAATATCTTG---AGGGATGGT
GTGCAATTAATTAAAACAGACACCTATCTAAATAATTTCAAATCATTGATAAAAAATTAT
ACAATACACCCAAAAACATTCAAATCAAATAACCGATTTTTCGACTTATTCTACAAT
>species3
ATGGCATGTAAAGTTGATAAAGTTTTAGAGCATCCTACCCAAAATGAAGAAACCTCA---
---------AAAAATTATATGAACAATTTGTTTTATTACAAAAATAATGAATTAAAAAAA
ATAGACTCATCATATTTTCAAGATAAATATTTAGGATTATTTTTTGGAGCCTCATGGTGT
AAATATTGTGTATCATTTATAAATAATTTAAATTTATTTAAAACTTATTTTCCTTTTTTT
GAAATTATATATATACCATTTGATCAAACATATACAGATTATATTAATTTTTTAAAAAAT
ACAAATTTTTATACTTTACCTTTTGATAATTATTTATATATAGCTAATAAATTTAAAGTC
AAAAATTTGCCATCTTTTATTATTATAGCACCAAATAATAATATACTTGTTAGGGATGGA
GTACAATTAATTAAAACTGACAATTATGTAAATAATTTCAAATCTTTGATAAAAAATTAT
ACAATACACCCCAAAACATTCAAATCAAATAATCGATTTTTCGACTTATTCTACAAT
>species4
ATGGCGTGCCAAGTTGATAACCCCCCTAAAACATACCCAAACGATAAAACAGCTGAATAC
GAAAAGTACGCAAATTATATGAACTATCTATATTATTATCAAAATAATGAATTAAAAAAA
ATCGATTCCTCTTATTTTAAAGATAAATATTTAGGATTATTTTTTGGAGCTTCATGGTGT
AAATACTGTGTAACCTTTATAGATAGCTTAAATATATTTAAAAAGAACTTCCCCAATGTT
GAAATTATATATATACCATTTGATAGAACATATCAAGAGTACCAATCCTTTTTAAAAAAT
ACAAACTTTTATGCTTTACCTTTTGATAATTATTTATATATATGTAAAAAGTATCAAATA
AAAAATCTACCTTCCTTTATGTTAATTACACCTAATAATAATATACTAGTAAAGGATGCA
GCACAATTAATTAAAACAGATGAATATATAAATAATTTAAAATCATTAATAAAAAATTAT
ATCATACATCCTAAAACGTTTCAATTTAATAATCGCTTTTTTGATTTGTTTCGTAAT
>species5
ATGAAATGCCAAGTGGATCGCCCCGTTACACCAAACGAAGAGCTAAATGGGGGCCAACAA
AATGTAGCCAAAAATTACATCCCCCATTTGTATCAATTCCAAAATAATGAAATGAAAAAA
ATCGATGCGTCTTACTTTGATAATAAATATCTGGGGCTATTTTTTGGAGCATCCTGGTGC
AGGTATTGCGTAACTTTCATCCAAAAAATAAATTTTTTTAAAAAGAATTTCCCCTTTATA
GAAATTATATACATCCCTTTTGACAAGACATATAATGATTATATAGCTTTCCTAAAAGGG
ACCGACTTTTACAGCCTTCCTTTTGATAACTATCTCTACGTTTGCAAAAAATTTAATGTT
CAAAATTTGCCATCCTTTATGATCATAGCCCCCAACAACAATGTGCTCGTCAAGGATGCC
GTGCAGCTCATCAAGACGGATGCCTACGTGGCGAACTTCAAGTCGTTGGTGAAAAATTAC
ACAATTCACCCGAACCAGTTTAAGTTTGGCAACCGATTTTTCGACTTATTTTGCGCA

3.1.2 Tree File(s)

Phylogenetic trees are required for an analysis.  IDEA can create these tree files for you using PhyML or PHYLIP (assuming the desired program is installed on your system).  PhyML estimates phylogenies using a maximum likelihood approach.  When using PHYLIP, phylogenetic trees will be estimated using maximum parsimony if six or fewer taxa are present. Otherwise, the neighbor-joining algorithm will be used. If multiple trees are found, the first one reported is used as input for PAML.

If you prefer to use trees that you have already created, your tree(s) should be in unrooted format.  If you are running IDEA on multiple datasets, you may have a separate tree file for each dataset.

3.1.3 Dataset List

When running IDEA on multiple datasets, an additional file is required.  This file should list the name of each PAMLseq input file, one filename per line.  Below is an example dataset list:

gene1.PAMLseq
gene2.PAMLseq
gene3.PAMLseq

If you intend to use existing phylogenetic trees, your dataset list should contain a second column listing the name of the tree file for each dataset.  The first and second columns should be separated by a tab.  Below is an example dataset list that includes tree filenames:

gene1.PAMLseq    gene1.tree
gene2.PAMLseq    gene2.tree
gene3.PAMLseq    gene3.tree

Note that IDEA interprets the alignment and tree filenames you specify as relative to your input directory.  They may be organized in subdirectories if you prefer.  Below is an example that uses subdirectories:

set1/alignments/gene1.PAMLseq    set1/trees/gene1.tree
set1/alignments/gene2.PAMLseq    set1/trees/gene2.tree
set2/alignments/gene3.PAMLseq    set2/trees/gene3.tree

3.2 Setting Parameters

Once you have prepared your input files, you are ready to begin your analysis by running the command idea .  You should see the following window:

Fig. 1: IDEA Start Page
IDEA Start Page


After you choose "Start New Analysis", you will have the option to set multiple parameters on subsequent pages.  Some of these parameters are described below.


PAML program Choose codeml to perform codon- or amino-acid-based analysis.
Choose baseml to perform nucleotide-based analysis.
IDEA mode Multi-dataset mode is the preferred method for analyzing multiple datasets.
It uses grid resources to execute many jobs simultaneously.
Dataset name list
(multi-dataset mode)
The name of the dataset list file described in section 3.1.3.
Input directory
(multi-dataset mode)
This directory should contain all the files described in section 3.1,
except possibly the dataset list.
Output directory
(multi-dataset mode)
This is the directory where all output of an IDEA run will go.
It is recommended that this not be the same as the input directory.
If you specify a directory that does not already exist, IDEA will attempt to create it for you.
It is recommended that no other files be stored in this directory.
runmode If you have only two sequences for each dataset and are running codeml, set runmode to -2 to perform a pairwise analysis.  This will save computation time and allow you to view a specialized output display.

If your dataset list includes both pairwise and non-pairwise datasets, setting runmode to -2 will result in a pairwise analysis for the pairwise datasets and a standard analysis for the non-pairwise datasets.

Setting runmode to 0 will always result in a standard analysis for all datasets.

Extra ω values are ignored in pairwise mode, as are certain PAML parameters.
Extra omega values
(codeml)
This IDEA feature allows you to specify additional starting values for ω.
Separate multiple values with spaces.
PAML will be run once for each starting value,
including the first starting value given as the parameter omega in the left column.
Afterwards, IDEA will choose the best run for each dataset and evolution model.
Extra ω values are ignored in pairwise mode (runmode -2).
PAML Parameters Mouse over the i icon next to a parameter for a brief note on that parameter.
For more detailed documentation, please refer to the PAML manual (version 4 or  3.15).


You may notice that your entries for some parameters are validated by IDEA for your convenience.  In particular, IDEA alerts you if the names of your sequence, tree and/or output files are too long (which would cause PAML to fail) and checks for errors in user-loaded configuration files.  IDEA's input validation is by no means exhaustive, and you are encouraged to ensure that your parameter settings are compatible with each other and with your data before starting analysis.

3.2.1 Saving Configuration

IDEA provides reasonable default values for most parameters.  However, if you frequently perform similar analyses or wish to repeat an analysis, it's a good idea to save your parameter choices so you won't have to enter them again.  To save the parameters you've chosen, choose "Save Configuration..." from the File menu.  Your file will be written in PAML's .ctl format.  This is compatible with running PAML outside of IDEA, but you will lose all non-PAML parameters, including directories and extra ω values.

It is recommended that you save your configuration prior to starting your run.

3.2.2 Loading Configuration

You may load parameters from a configuration file you saved previously or from any codeml.ctl or baseml.ctl file you already have.  To do so, choose "Load configuration..." in the File menu.  After loading your configuration, you may modify parameters as you see fit.

3.3 Monitoring Progress

When you are satisfied with your parameter choices, press the Start button.
You may not change the parameters you have chosen after analysis has started.

IDEA will use the Workflow system to distribute your jobs over the grid.  For each dataset, IDEA may perform the following steps:

• Create a tree using PhyML or PHYLIP.  This step will be skipped if you have chosen to use your own trees.
• Run either codeml or baseml.
• Merge separate runs of codeml if you gave multiple starting ω values.
• Produce a tabular text summary of results.  This file will be located in the output directory you specified and will have the suffix .summary .  If you are running codeml and chose at least one nested pair of NSsites models, an additional file with the suffix .lrt will be produced.  Its contents will be the results of a likelihood ratio test performed by running the PAML program chi2.

To monitor the progress of your analysis, click the Monitor button.  This will bring up a Workflow monitor in a separate window.  A process's output may be viewed by selecting the process in the tree at left and clicking the View Out button (for standard output) or the View Err button (for error output) at right.  Because there is a time lag in relaying this information to the monitor, in-monitor output viewing is most useful for multi-dataset IDEA runs.

You may close the monitor window at any time.  However, do not close the main IDEA window until your jobs have finished.  Doing so will cause your analysis to be aborted.

Note:  When analyzing a very large number of datasets, the Workflow monitor may become unresponsive.  This has no impact on the running jobs.  In this case, you may close the monitor or leave it open.  However, do not close the main IDEA window until your jobs have finished, or your analysis will be aborted.

3.4 Troubleshooting

At times, one or more steps of the IDEA pipeline may fail or may not produce the results you expect.  To assist you in troubleshooting a failed IDEA run, the console output of each step in the pipeline is available in your output directory.  The output files are named as follows, where <dataset name> is the name of an alignment file, or "ONLY" in the case of a single-dataset analysis, and yyyy-mm-dd is the date on which the analysis was started:

Standard output: Standard error:
idea.create-tree.<dataset name>.out.yyyy-mm-dd
idea.run-paml.<dataset name>.out.yyyy-mm-dd
idea.merge-runs.<dataset name>.out.yyyy-mm-dd
idea.parse-output.<dataset name>.out.yyyy-mm-dd
idea.create-tree.<dataset name>.err.yyyy-mm-dd
idea.run-paml.<dataset name>.err.yyyy-mm-dd
idea.merge-runs.<dataset name>.err.yyyy-mm-dd
idea.parse-output.<dataset name>.err.yyyy-mm-dd

The log files <output directory>/idea.log and/or <output directory>/workflow/idea.xml.log, if present, may also contain useful information.


4 Viewing Results

Once your analysis is finished, you will see a message indicating whether it succeeded.  If so, click the View Results button to get an interactive display of your results.  This display is intended for viewing the results of ‘site models’codeml analyses (seqtype = 1; model = 0), although a small subset of its features are also applicable to baseml analyses and certain other codeml analyses.

To view results of a previously completed analysis or partial results for a not-yet-completed analysis, choose "View Results of Previous Analysis" from the start page.  Then choose "Load Results" in the File menu.  Select the directory you gave as the output directory and click Load.

The interactive display has several components, as described below.

4.1 Data Table

The data table is the most prominent display component and the only display component in the case of a pairwise analysis.  It displays data for each dataset and evolutionary model in several columns:

Dataset:
the name of each dataset
This is shown as the name of the corresponding alignment file as described in section 3.1.1.

n (non-pairwise mode only):
the number of sequences/variants in a dataset

Model:
one of several models for how ω is allowed vary among sites
This corresponds to PAML's NSsites parameter.
   
Likelihood Score:
the lnL score for a particular model, as computed by PAML
If PAML was run with multiple starting ω values, the run that produced the best score is used.
A less negative score indicates a likelier model.  The likeliest model for each dataset is shown in bold to make it easy to identify.  One can test the hypothesis that positive selection is occurring by comparing a model that allows ω > 1 for some sites with another that does not using a likelihood ratio test.

Tree Length:
the estimated number of substitutions per site along all branches in the tree

dN (pairwise mode only):
the number of nonsynonymous substitutions per nonsynonymous site

dS (pairwise mode only):
the number of synonymous substitutions per synonymous site

ω:
dN/dS, a measure of selective pressure

κ:
ts/tv, the transition/transversion rate ratio

The data may be sorted based on any column.  Use the sort ascending globally and sort descending globally buttons to sort across datasets.  Use the sort ascending and sort descending buttons to sort the models within each dataset.

4.1.1 Histograms

For some columns, a histogram (show histogram) button is also available.  Press this button to see an interactive histogram of the data points in the corresponding column.  In non-pairwise mode, you will be prompted to select a single model of evolution on which to base the histogram.  Use the "Number of bins" slider to dynamically adjust the number of bins between two and 50 (and thus adjust the bin size).  You can also switch models by selecting a different model from the drop-down box at the top of the window.  Press the "Save" button to save the histogram as a JPEG image.

Fig. 2: Adjustable Histogram
Adjustable Histogram

4.1.2 Detailed Output

Although IDEA displays many useful values at a glance, you may at times wish to examine the more detailed output PAML provides.  Click on a model name for any dataset to view PAML's output for that dataset.  The output will be presented in a scrollable window that is automatically scrolled to the start of the results for the model you clicked on; you may view results for other models by scrolling up or down.  Note that you may move this window and continue to perform other functions while viewing the detailed output.

4.1.3 Likelihood Ratio Tests

The input parameter NSsites is used to specify models that allow ω to vary across sites.  The available choices include pairs of nested models which are identical except that one allows some sites to have ω > 1.  Comparing the likelihood of the observed data under each model therefore amounts to a test of the hypothesis that some sites are under positive selection.  For each such pair you selected, a likelihood ratio test should have been performed as part of the final step of the IDEA pipeline.  If the test is significant at the 5% level, a check will be visible to the right of the likelihood score for the alternative (more complicated) model; otherwise, an X will be visible in its place.  Mousing over the check or X icon will bring up a display of the details of the likelihood calculation similar to that below.

Fig. 3: Likelihood Ratio Test Details
likelihood ratio test details

4.1.4 Saving the Table

To save the table in tabular text format, choose "Save Table" in the File menu.

4.2 Selected Sites

In non-pairwise mode, the bottom of the screen is devoted to the display of selected sites.  Click on any row in the table (except rows for model 0-one-ratio) to bring up a display of selected sites for that dataset and evolution model.  You will see the amino acid sequence for that dataset.  Above each amino acid are one or more colored bars representing the probability that ω at that site falls into each of the site classes allowed by the model.  (Although ω can really take on continuous values, PAML's models assume it has one of several discrete values.)  A color key listing the ω value for each site class can be found at the top left of the display.  The height of each colored bar is proportional to the probability that ω at that site is in the matching site class; probabilities sum to 1.  The most probable site class for each site is shown as a colored square under the amino acid.  Some models, such as 2-PositiveSelection, 3-discrete and 8-beta&w>1, may have a site class for which ω > 1 (indicating that positive selection is likely at certain sites).  In such cases, amino acids for which the most likely ω value is > 1 will be shown in white on black.  The numbers directly above the colored bars indicate position (in amino acids) on the sequence.

The selected sites display will be based on PAML's Bayes empirical Bayes analysis when it is available; it will be based on PAML's Naïve empirical Bayes analysis otherwise.  The analysis used will be noted in the title of the selected sites display.

Occasionally, the selected sites cannot be visualized.  This is usually the result of errors during the execution of PAML, which are in turn usually caused by errors in the input data.  In the case of such a failure, you are given the opportunity to browse the text output of the display-creation command in order to find the error.

Note:  ω values ≥ 100 for site classes may be shown incorrectly in the color key because ω values ≥ 1000 may be truncated in PAML's output (for example, an ω value of 1100 for a site class could be truncated to 100).  This is a known problem in PAML and does not affect the overall ω values listed in the data table.

The portion of the code that creates this picture was contributed by Jonathan Crabtree.

4.3 Phylogenetic Trees

In non-pairwise mode, the right side of the screen is devoted to the display of selected sites.  Click on the Tree button in any row to display a phylogenetic tree for the selected dataset based on the selected model.  As an alternative, you can select a dataset and model from the drop-down boxes in the tree area and press Display.  The tree displayed will be drawn to scale, using the branch lengths estimated by PAML.  To see a close-up view, click "click to enlarge".

The portion of the code that creates this picture was contributed by Jonathan Badger.

4.4 Results Not Obtained Using IDEA

IDEA's output display is designed to display output generated by IDEA.  However, you may use it to display non-IDEA-generated PAML output.  To do so, place the following files in one directory:

list.txt This should be a list with the name of one sequence file on each line.
There may optionally be a second column containing the name of one tree file for each
sequence file.
For the purposes of the output display, the sequence files listed in list.txt need not actually exist.
<sequence file name>.lrt (Optional)
One such file may be provided for each sequence file listed in list.txt.
To view LRT results, generate these files by calling idea-D-parse-output.pl.
sequence file name>.mlc
-OR-
<sequence file name>.SINGLE.PAMLout.merged
One such file is required for each sequence file listed in list.txt.
This should be a PAML output file.
<sequence file name>.mst To view selected sites, one such file is required for each sequence file listed in list.txt.
This should be an RST file as output by PAML.
(The .mst suffix reflects the fact that IDEA generates a merged RST file.)


Any of these files may be a symbolic link to a file in another location.

Once you have placed all these files in one directory, simply select that directory when loading results.

4.5 Examining Flat Files

Like any PAML analysis, an IDEA analysis results in traditional text output files.  At times, you may wish to examine these files.  Look for files with the following names:

Multiple-dataset analyses: Single-dataset analyses:
<dataset name>.PAMLtree
<dataset name>.wX_X.codeml.ctl
*
<dataset name>.wX_X.lnf*
<dataset name>.wX_X.rst*
<dataset name>.mst** (merged rst)
<dataset name>.wX_X.PAMLout*
<dataset name>.mlc** (merged PAMLout)
<dataset name>.summary
<dataset name>.lrt
2NG.dN
2NG.dS
2NG.t
MyDataset.PAMLtree
ONLY.wX_X.codeml.ctl
*
ONLY.wX_X.lnf*
ONLY.wX_X.rst*
ONLY.mst** (merged rst)
rates
rst1
rub
<output file name>.wX_X
*
<output file name>.merged
** (merged PAMLout)
<output file name>.summary
<output file name>.lrt

* These files are parameterized by ω; there is one copy of each of these files for each starting ω value.  For example, the file ONLY.w1_5.rst would correspond to the starting ω value 1.5.
** These files contain the merged results of runs with different starting ω values.


5 New in IDEA 2.5

New features in IDEA 2.5 include:

PhyML:
PhyML has now replaced PHYLIP as the standard software for creating trees.  Note that PhyML is not supported on Solaris.  PHYLIP is still available as an alternative.

Support for PAML 4.3


Further Information

Please visit the IDEA Support and Discussion Forum to request support, provide feedback and discuss IDEA with other users.  Using this public forum will help the IDEA research team provide you with a timely response.

6.1 How to Cite IDEA

Egan A., A. Mahurkar, J. Crabtree, J.H. Badger, J.M. Carlton and J.C. Silva.
IDEA:  Interactive Display for Evolutionary Analyses.
BMC Bioinformatics 2008, 9:524
.

Please remember that if you use IDEA, you should also cite PAML, PhyML and PHYLIP.